miRNA Mature hsa-miR-764 [Human]

The following mature miRNA have the same seed sequence: CAGGUGC

ID	hsa-miR-764
Accession	MIMAT0010367
Sequence	11 - GCAGGUGCUCACUUGUCCUCCU - 32
Seed Sequence	CAGGUGC

miRNA-Specific Assays for Results You Can Trust

Streamline your workflow with assays designed for this miRNA. Our targeted qPCR assays help you generate meaningful data – efficiently and accurately.

Functional Analysis - Inhibitors
Functional Analysis - Mimics
Localization Studies
qPCR Expression - SYBR
qPCR Expression - Probe

Country and Language

Explore dPCR & qPCR assay portfolio

Unlock Deeper Insights with GeneGlobe Tutorials

miRNA Mature hsa-miR-764

miRNA-Specific Assays for Results You Can Trust