The following mature miRNA have the same seed sequence: UGCUAAG
| ID | hsa-miR-4639-5p |
| Accession | MIMAT0019697 |
| Sequence | 1 - UUGCUAAGUAGGCUGAGAUUGA - 22 |
| Seed Sequence | UGCUAAG |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- mocetinostat
- nilotinib
- trichostatin A
- vorinostat
- HDAC11