dPCR Microbial DNA Detection Assay for Erysipelothrix rhusiopathiae
GeneGlobe ID: DMA00139 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Erysipelothrix rhusiopathiae
GeneGlobe Cat.No. (Assay ID)
DMA00139
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Erysipelothrix rhusiopathiae (1648)
Bacillus insidiosus
Bacillus rhusiopathiae suis
Bacterium rhusiopathiae
Erysipelothrix erysipeloides
Erysipelothrix insidiosa
Erysipelothrix murisepticus
Erysipelothrix porci
Bacillus insidiosus
Bacillus rhusiopathiae suis
Bacterium rhusiopathiae
Erysipelothrix erysipeloides
Erysipelothrix insidiosa
Erysipelothrix murisepticus
Erysipelothrix porci
Template accession
NZ_ACLK01000021.1
Taxonomy
Bacteria
Secondary targets/specificity
Erysipelothrix muris (380638)
'Erysipelothrix muris'
Erysipelothrix piscisicarius (2485784)
Erysipelothrix tonsillarum (38402)
Erysipelothrix rhusiopathiae serovar 7
'Erysipelothrix muris'
Erysipelothrix piscisicarius (2485784)
Erysipelothrix tonsillarum (38402)
Erysipelothrix rhusiopathiae serovar 7
Application field
Food Production
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
CCCTCTCAGGTCGGCTACGCATCATCGTCTTGGTAAGCCGTTACCTTACCAACTAACTAATGCGCCATAAGCCCATCTCGTTGTGATGTATCCCATCTTTAATTAATCTAAGATGTCTTAGATTAACGTATCCGGTATTAGCAGAAGTTT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Erysipelothrix rhusiopathiae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Erysipelothrix rhusiopathiae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Erysipelothrix rhusiopathiae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Erysipelothrix rhusiopathiae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Erysipelothrix rhusiopathiae and elevate your work to new heights.