dPCR Microbial DNA Detection Assay for Gemella bergeri
GeneGlobe ID: DMA00158 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Gemella bergeri
GeneGlobe Cat.No. (Assay ID)
DMA00158
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Gemella bergeri (84136)
Gemella bergeriae
Gemella bergeriae
Template accession
NR_026420.1
Taxonomy
Bacteria
Application field
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
ACCTGCCTTATAGACTGGGATAACTACGGGAAACTGTAGCTAATACCGGATAACAACATTTTCCGCATGGGAGATGTTTAAAAGTTGGTGAAGCTAACACTATAAGATGGCTTTGCGGAGCATTAGCTAGTTGGTGGGATAAAAG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Gemella bergeri, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Gemella bergeri models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Gemella bergeri facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Gemella bergeri studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Gemella bergeri and elevate your work to new heights.