dPCR Microbial DNA Detection Assay for Pediococcus pentosaceus

GeneGlobe ID: DMA00253 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Pediococcus pentosaceus
GeneGlobe Cat.No. (Assay ID)​
DMA00253
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Pediococcus pentosaceus (1255)
Pediococcus hennebergii
Template accession​
NC_008525.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Lactiplantibacillus plantarum (1590)
Lactobacillus arabinosus
Lactobacillus arizonensis
Lactobacillus plantarum (Orla-Jensen 1919) Bergey et al. 1923 (Approved Lists 1980)
Lactobacterium plantarum
Streptobacterium plantarum
Pediococcus acidilactici (1254)
Pediococcus acidilactici Lindner 1887 (Approved Lists 1980) emend. Judicial Commission 1996
Pediococcus lindneri
Pediococcus lolii
Application field​
Food Production
Fermentation and Degradation
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTCCAGGTGTTATCCCCTACTTCTGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTCACTTCGTGTTAAAATCTCAATCAGTACAAGTACGTCATAATCAATTAACGGAAGTTCGTTCGACT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pediococcus pentosaceus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pediococcus pentosaceus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pediococcus pentosaceus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pediococcus pentosaceus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pediococcus pentosaceus and elevate your work to new heights.