dPCR Microbial DNA Detection Assay for Prevotella bivia
GeneGlobe ID: DMA00262 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
dPCR wet-lab verified
Product name
Prevotella bivia
GeneGlobe Cat.No. (Assay ID)
DMA00262
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Prevotella bivia (28125)
Bacteroides bivius
Bacteroides bivius
Template accession
L16475.1
Taxonomy
Bacteria
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
ACATGCAAGTCGAGGGGCAGCGAATAGATAGCTTGCTATTTATGTCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTACCCATAACTAAGGGATAACCCAGCGAAAGTTGGACTNATACCTNATGTATTCGTTTGATCTCATGAGATTNCGAATAAAGAT
Reaction size
200rxns
Product Resources
File Size: 249.07 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Prevotella bivia, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Prevotella bivia models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Prevotella bivia facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Prevotella bivia studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Prevotella bivia and elevate your work to new heights.