dPCR Microbial DNA Detection Assay for Staphylococcus epidermidis
GeneGlobe ID: DMA00304 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
dPCR wet-lab verified
Product name
Staphylococcus epidermidis
GeneGlobe Cat.No. (Assay ID)
DMA00304
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Staphylococcus epidermidis (1282)
Albococcus epidermidis
Micrococcus epidermidis
Staphylococcus epidermidis albus
Albococcus epidermidis
Micrococcus epidermidis
Staphylococcus epidermidis albus
Template accession
NZ_ACJC01000191.1
Taxonomy
Bacteria
Secondary targets/specificity
Staphylococcus pettenkoferi (170573)
Staphylococcus haemolyticus (1283)
Staphylococcus aureus (1280)
Micrococcus aureus
Micrococcus pyogenes
Staphlococcus pyogenes citreus
Staphylococcus aureus subsp. anaerobius
Staphylococcus pyogenes aureus
Staphylococcus saprophyticus (29385)
Staphylococcus saprophyticus subsp. bovis
Staphylococcus haemolyticus (1283)
Staphylococcus aureus (1280)
Micrococcus aureus
Micrococcus pyogenes
Staphlococcus pyogenes citreus
Staphylococcus aureus subsp. anaerobius
Staphylococcus pyogenes aureus
Staphylococcus saprophyticus (29385)
Staphylococcus saprophyticus subsp. bovis
Application field
Sepsis
Multiple Drug Resistance
Multiple Drug Resistance
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TACCTTACCAACTAGCTAATGCGGCGCGGATCCATCTATAAGTGACAGCAAAACCGTCTTTCACTATTGAACCATGCGGTTCAATATATTATCCGGTATTAGCTCCGGTTTCCCGAAGTTATCCCAGTCTTATAGGTAGGTTATCCACGTGTTACTCACCCGTCCGCCGCTAACGTCAGAGGAGCAAGCTCCTCGTCTGTTCGCTCGACTTGCATGTATTAG
Reaction size
200rxns
Product Resources
File Size: 271.34 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Staphylococcus epidermidis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Staphylococcus epidermidis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Staphylococcus epidermidis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Staphylococcus epidermidis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Staphylococcus epidermidis and elevate your work to new heights.