dPCR Microbial DNA Detection Assay for Mucor hiemalis

GeneGlobe ID: DMA00368 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the 18S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Mucor hiemalis
GeneGlobe Cat.No. (Assay ID)​
DMA00368
Target type​
Microbial Id
Target region​
18S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Mucor hiemalis (64493)
Mucor sp. heimalis
Template accession​
JQ912672.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Amylomyces rouxii (29923)
Mucor rouxii
Mucor irregularis (713888)
Mucor irregularis Stchigel, Cano, Guarro & Alvarez, 2011, nom. nov.
Rhizomucor variabilis R.Y. Zheng & G.Q. Chen, 1991
Application field​
Food Production
Fermentation and Degradation
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GTACACACCGCCCGTCGCTACTACCGATTGAATGGTTATAGTGAGCATATGGGATCAGTAGGATTAAACTGGCAACAGTTTTTCCCTGCAGAGAACTATGGCAAACTAGGCTATTTAGAGGAAGT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 201.47 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mucor hiemalis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mucor hiemalis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mucor hiemalis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mucor hiemalis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mucor hiemalis and elevate your work to new heights.