dPCR Microbial DNA Detection Assay for Mucor hiemalis
GeneGlobe ID: DMA00368 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Fungal detection assay targeting the 18S ribosomal RNA gene
dPCR wet-lab verified
dPCR wet-lab verified
Product name
Mucor hiemalis
GeneGlobe Cat.No. (Assay ID)
DMA00368
Target type
Microbial Id
Target region
18S ribosomal RNA gene
Target (NCBI taxonomy ID)
Mucor hiemalis (64493)
Mucor sp. heimalis
Mucor sp. heimalis
Template accession
JQ912672.1
Taxonomy
Plants and Fungi
Secondary targets/specificity
Amylomyces rouxii (29923)
Mucor rouxii
Mucor irregularis (713888)
Mucor irregularis Stchigel, Cano, Guarro & Alvarez, 2011, nom. nov.
Rhizomucor variabilis R.Y. Zheng & G.Q. Chen, 1991
Mucor rouxii
Mucor irregularis (713888)
Mucor irregularis Stchigel, Cano, Guarro & Alvarez, 2011, nom. nov.
Rhizomucor variabilis R.Y. Zheng & G.Q. Chen, 1991
Application field
Food Production
Fermentation and Degradation
Fermentation and Degradation
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GTACACACCGCCCGTCGCTACTACCGATTGAATGGTTATAGTGAGCATATGGGATCAGTAGGATTAAACTGGCAACAGTTTTTCCCTGCAGAGAACTATGGCAAACTAGGCTATTTAGAGGAAGT
Reaction size
200rxns
Product Resources
File Size: 201.47 KBLanguage: English
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mucor hiemalis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mucor hiemalis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mucor hiemalis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mucor hiemalis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mucor hiemalis and elevate your work to new heights.