dPCR Microbial DNA Detection Assay for Gardnerella vaginalis (2)

GeneGlobe ID: DMA00408 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the sialidase A gene
Product name​
Gardnerella vaginalis (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00408
Target type​
Microbial Id
Target region​
Sialidase A gene
Target (NCBI taxonomy ID)​
Gardnerella vaginalis 409-05 (553190)
Gardnerella vaginalis str. 409-05
Gardnerella vaginalis strain 409-05
Template accession​
CP002104
Taxonomy​
Bacteria
Application field​
Human Microbiome
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCCGCTTTTCCGCTCACTCTTTGCGGCCCAAGATTCGTTGCGCTCGCAAAGCATTGGTATCCGTCTAAATAGAATCGGCTTCCAAAACTTCCGTACGTTATTGCAAAATCGTGTTCGCGCCCGTCGCATGCGCCTAG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Gardnerella vaginalis (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Gardnerella vaginalis 409-05 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Gardnerella vaginalis (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Gardnerella vaginalis 409-05 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Gardnerella vaginalis (2) and elevate your work to new heights.