dPCR Microbial DNA Detection Assay for Proteus mirabilis
GeneGlobe ID: DMA00474 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting an intergenic region
dPCR wet-lab verified
dPCR wet-lab verified
Product name
Proteus mirabilis
GeneGlobe Cat.No. (Assay ID)
DMA00474
Target type
Microbial Id
Target region
Intergenic region
Target (NCBI taxonomy ID)
Proteus mirabilis (584)
Template accession
EU635879.1
Taxonomy
Bacteria
Application field
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
CATAGTGTTTACTGGGCTGCGAGCAATTTGTCTATTTCTTCATCATATTTTATGCTAATAAACACTTTTTATGATTATTTTTTCAGCATGATATAGCGATATTTCAACCAGTTTACGCTAAGTGACTTATCCTAGAGAGATACAACAGCAAGGGGCGGTTTACAGCCTATTGATAAGCTTTTATTATCCTTTAATCAAGTCTTACCGTGCGCACTGGCTAAGATGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Proteus mirabilis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Proteus mirabilis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Proteus mirabilis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Proteus mirabilis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Proteus mirabilis and elevate your work to new heights.