dPCR Microbial DNA Detection Assay for SHV(156D)

GeneGlobe ID: DMA00513 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Resistance gene detection assay targeting the bacterial SHV family beta-lactamase gene
Product name​
SHV(156D)
GeneGlobe Cat.No. (Assay ID)​
DMA00513
Target type​
Antibiotics Resistance
Target region​
Bacterial SHV family beta-lactamase gene
Target (NCBI taxonomy ID)​
Class A beta-lactamase
Template accession​
FJ685656.1
Taxonomy​
Resistance Genes
Application field​
Beta-lactam Resistance
Antibiotic Resistance (AMR)
Multiple Drug Resistance
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CCCGCAGGATTGACTGCCTTTTTGCGCCAGATCGACGACAACGTCACCCGCCTTGACCGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACTACCCCGGCCAGCATGGCCGCGACCCTGCGC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for SHV(156D), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Class A beta-lactamase models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for SHV(156D) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Class A beta-lactamase studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for SHV(156D) and elevate your work to new heights.