GeneGlobe ID: DMA00837 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A
Product Specification
Viral detection assay
Alternative names of species: HHV-6A, Human B-lymphothrophic virus, HBLV, Human herpesvirus 6A, Human betaherpesvirus 6A
dPCR wet-lab validated
Alternative names of species: HHV-6A, Human B-lymphothrophic virus, HBLV, Human herpesvirus 6A, Human betaherpesvirus 6A
dPCR wet-lab validated
Product name
Human betaherpesvirus 6A
GeneGlobe Cat.No. (Assay ID)
DMA00837
Target type
Microbial Id
Target region
U90
Target (NCBI taxonomy ID)
Human betaherpesvirus 6A (32603)
Human herpesvirus 6A
Human herpesvirus 6A
Template accession
KP257584.1
Taxonomy
Viruses
Application field
Herpes Panel
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TAAAGGGTTGCCATTGGAACCATCTTGTTCTGTCCCTTCAACTACTGAATCACATTGAGTGTCAAGTAGTCTTTCTAGCAACATGTTTTTACAACTCTGGAGGCCGCTGATGGAATTCAAGTTATCAGGGCCGCCC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A and elevate your work to new heights.