GeneGlobe ID: DMA00837 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A

Product Specification

Viral detection assay
Alternative names of species: HHV-6A, Human B-lymphothrophic virus, HBLV, Human herpesvirus 6A, Human betaherpesvirus 6A
dPCR wet-lab validated
Product name​
Human betaherpesvirus 6A
GeneGlobe Cat.No. (Assay ID)​
DMA00837
Target type​
Microbial Id
Target region​
U90
Target (NCBI taxonomy ID)​
Human betaherpesvirus 6A (32603)
Human herpesvirus 6A
Template accession​
KP257584.1
Taxonomy​
Viruses
Application field​
Herpes Panel
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TAAAGGGTTGCCATTGGAACCATCTTGTTCTGTCCCTTCAACTACTGAATCACATTGAGTGTCAAGTAGTCTTTCTAGCAACATGTTTTTACAACTCTGGAGGCCGCTGATGGAATTCAAGTTATCAGGGCCGCCC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6A and elevate your work to new heights.