QiagenGeneGlobe
Custom Products Analyze Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Assay Wizard
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
icon_0009_cart-s Cart icon_0071_person-s My Account
null
null
A simple and rapid plate-based workflow

dPCR Microbial DNA Detection Assay for tetW

GeneGlobe ID: DMA00842 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Resistance gene detection assay
Alternative names of species: tetracycline resistance gene
dPCR wet-lab verified
Product name​
tetW
GeneGlobe Cat.No. (Assay ID)​
DMA00842
Target type​
Antibiotics Resistance
Target region​
tetracycline resistance (tetW) gene
Target (NCBI taxonomy ID)​
tetW
Template accession​
DQ060146.3
Taxonomy​
Resistance Genes
Application field​
Antibiotic Resistance (AMR)
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AAAGACGACCTTGACGGAGAGCCTGCTATATGCCAGCGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGATTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
dPCR Microbial Detection Assay Catalog
PDF (268.42 KB)
dPCR Microbial Detection Assay Catalog
XLSX (92.93 KB)
Quick-Start Protocols (1)
dPCR Microbial DNA Detection Assays and Custom dPCR Microbial Assays Quick-Start Protocol
PDF (675KB)
Application Notes (2)
Advancing higher-order multiplex PCR: Overcoming the limitations of qPCR with QIAcuity digital PCR
PDF (3MB)
Higher-order multiplexing on QIAcuity: 12-plex dPCR capabilities for detailed biological analysis
PDF (563KB)
Technical Information (1)
dPCR Microbial DNA Detection Assays - Assay/target list
PDF (200KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Microbial DNA dPCR Handbook
PDF (449KB)
Scientific Posters (1)
Accurate and sensitive detection of microbial DNA and RNA targets using nanoplate dPCR
PDF (322KB)
Brochures & Guides (2)
dPCR Microbial DNA Detection Assays Product Profile
PDF (405KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Making the invisible visible
PDF (2MB)
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
Introducing the dPCR Microbial DNA Detection Assay for tetW, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with tetW models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for tetW facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for tetW studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for tetW and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–26. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum