GeneGlobe ID: DMA00862 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Human parvovirus B19

Product Specification

Viral detection assay
Alternative names of species: B19V, B19 virus, Erythrovirus B19
dPCR wet-lab validated
Product name​
Human parvovirus B19
GeneGlobe Cat.No. (Assay ID)​
DMA00862
Target type​
Microbial Id
Target region​
Non-structural protein (NS1) gene
Target (NCBI taxonomy ID)​
Human parvovirus B19 (10798)
B19 virus
Erythrovirus B19
Human erythrovirus B19
Parvovirus B19
Template accession​
NC_000883.2
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, CviQI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GACCACTATGAAAACTGGGCAATAAACTACACTTTTGATTTCCCTGGAATTAATGCAGATGCCCTCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGAAAGCAGCTTTTTTAACCTCATCACCCCAGGCGCCTGGAACACTGAAACCCCGC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human parvovirus B19, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human parvovirus B19 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human parvovirus B19 and elevate your work to new heights.