GeneGlobe ID: DMA00862 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Human parvovirus B19
Product Specification
Viral detection assay
Alternative names of species: B19V, B19 virus, Erythrovirus B19
dPCR wet-lab validated
Alternative names of species: B19V, B19 virus, Erythrovirus B19
dPCR wet-lab validated
Product name
Human parvovirus B19
GeneGlobe Cat.No. (Assay ID)
DMA00862
Target type
Microbial Id
Target region
Non-structural protein (NS1) gene
Target (NCBI taxonomy ID)
Human parvovirus B19 (10798)
B19 virus
Erythrovirus B19
Human erythrovirus B19
Parvovirus B19
B19 virus
Erythrovirus B19
Human erythrovirus B19
Parvovirus B19
Template accession
NC_000883.2
Taxonomy
Viruses
Application field
Human Pathogens
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI
Template present in Microbial DNA Positive Control
No
Region of Interest
GACCACTATGAAAACTGGGCAATAAACTACACTTTTGATTTCCCTGGAATTAATGCAGATGCCCTCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGAAAGCAGCTTTTTTAACCTCATCACCCCAGGCGCCTGGAACACTGAAACCCCGC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human parvovirus B19, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human parvovirus B19 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human parvovirus B19 and elevate your work to new heights.