QiagenGeneGlobe
 Custom Products Analyze Data Knowledge Services
icon_0009_cart-s Cart

miScript miRNA Mimics

For studies on miRNA function and gene regulation using synthetic miRNA

  • Ready-to-transfect mimics behave like endogenous miRNAs
  • Available for all human, mouse, and rat miRNAs in miRBase
  • Highly flexible formats, scales, and grades
  • Easy to order via GeneGlobe

Read more on QIAGEN
Product

Product List2 products

Product Comparison

Match and evaluate all visible assays in a clear, structured table. Export the results, collaborate with colleagues, or dive into detailed specs.

Filter by keywords
Find the best to meet your needs using keyword or target search
GeneGlobe ID: MSY0000338 | Cat. No.: 219600 | miScript miRNA Mimics
Syn-dme-miR-277-3p miScript miRNA Mimic
targets mature miRNA: dme-miR-277-3p MIMAT0000338: 5 'UAAAUGCACUAUCUGGUACGACA
Product Specification
GeneGlobe ID: MSY0020804 | Cat. No.: 219600 | miScript miRNA Mimics
Syn-dme-miR-277-5p miScript miRNA Mimic
targets mature miRNA: dme-miR-277-5p MIMAT0020804: 5 'CGUGUCAGGAGUGCAUUUGCA
Product Specification
You've viewed 2 of 2 Products
Load more products

Resources

Safety Data Sheets (1)
Safety Data Sheets
Kit Handbooks (2)
(EN) Guidelines for miRNA mimic and miRNA inhibitor experiments
PDF (404KB)
(EN) - Guidelines for experiments using miScript Target Protectors
PDF (518KB)
For miRNA function research
Brochures & Guides (2)
microRNA Sample and Assay Technologies (eBook)
Total RNA Discovery - (EN)
PDF (255KB)
Simultaneously profile mRNA, miRNA and lncRNA using a simple, complete workflow
miRNA Research (1)
microRNA Sample and Assay Technologies - (EN)
PDF (2MB)
Certificates of Analysis (1)
Certificates of Analysis
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–25. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum