Syn-hsa-miR-1201 miScript miRNA Mimic

GeneGlobe ID: MSY0005864 | Cat. No.: 219600 | miScript miRNA Mimics

Product Specification

icon_0124_cc_gen_document-s

Product specification not yet available

We’re still working on finalizing the specifications for this product. In the meantime, our technical specialists are happy to help with any questions or details you need.

Need More Details?

targets mature miRNA: hsa-miR-1201 MIMAT0005864: 5 'AGCCUGAUUAAACACAUGCUCUGA

Resources

Safety Data Sheets (1)
Brochures & Guides (2)
Simultaneously profile mRNA, miRNA and lncRNA using a simple, complete workflow
miRNA Research (1)
Introducing the Syn-hsa-miR-1201 miScript miRNA Mimic, a cutting-edge addition to our miScript miRNA Mimics lineup, specifically designed for RNA Regulation applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the Syn-hsa-miR-1201 miScript miRNA Mimic facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA Regulation, or any other sophisticated analyses, this product from our miScript miRNA Mimics collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with Syn-hsa-miR-1201 miScript miRNA Mimic and elevate your work to new heights.