dPCR Microbial DNA Detection Assay for Campylobacter sputorum

GeneGlobe ID: DMA00087 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Campylobacter sputorum
GeneGlobe Cat.No. (Assay ID)​
DMA00087
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Campylobacter sputorum (206)
Campylobacter sputorum (Prevot 1940) Veron and Chatelain 1973
Template accession​
GQ035643.1
Taxonomy​
Bacteria
Application field​
Food Production
Human Microbiome
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGGGCGTAAAGGACGCGTAGGTGGATAGATAAGTCTCTTGTGAAATCTAGTAGCTTAACTACTAAACTGCTTGGGAAACTATTTATCTAGAGTAAGGGAGAGGCAGATGGAATTCTTGGTGTAGGGGTAAAATCCGTAGAT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 292.93 KBLanguage: English

Resources

Introducing the dPCR Microbial DNA Detection Assay for Campylobacter sputorum, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter sputorum models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Campylobacter sputorum facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter sputorum studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Campylobacter sputorum and elevate your work to new heights.