dPCR Microbial DNA Detection Assay for Hepatitis B

GeneGlobe ID: DMA00808 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: HBV,
Human hepatitis B virus
hepatitis B virus (HBV)
hepatitis B virus HBV
hepatitis B virus, HBV
human hepatitis B virus HBV
dPCR wet-lab validated
Product name​
Hepatitis B
GeneGlobe Cat.No. (Assay ID)​
DMA00808
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Hepatitis B virus (10407)
HBV
hepatitis B virus (HBV)
hepatitis B virus HBV
hepatitis B virus, HBV
Human hepatitis B virus
human hepatitis B virus HBV
Template accession​
NC_003977.2
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAACTACCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 88.12 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Hepatitis B, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Hepatitis B virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Hepatitis B facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Hepatitis B virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Hepatitis B and elevate your work to new heights.