dPCR CNV Probe Centromeric for ANKRD30B

GeneGlobe ID: DCC0000510 | Cat. No.: 250212 | dPCR CNV Probe Assays

Product Specification

Gene symbol: ANKRD30B
Ensembl Gene ID: ENSG00000180777
dPCR wet-lab verified
Centromeric 18 chromosome
Product Name​
dPCR CNV Probe Centromeric for ANKRD30B
GeneGlobe Cat.No. (Assay ID)​
DCC0000510
Assay type​
Centromeric
Species​
Human (Homo sapiens)
Gene symbol​
ANKRD30B
Ensembl Gene ID​
ENSG00000180777
NCBI Gene Id​
374860
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
119
Amplicon region​
AAATATTCTCATAGATGCTGGTGCTGATCTAAATTATGTAGATGTGTATGGCAACACGGCTCTCCATTATGCCGTTTATAGTGAGAATTTGTTAATGGTGGCAACACTGCTGTCCTATGGTGCAGTCATCGAGGTGCAAAACAAGGTAG
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab verified​
dPCR wet-lab verified
Hydrolysis Probe​
HEX, ROX
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns and 1000rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 222.88 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (1)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Protocols (4)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR CNV Probe Centromeric for ANKRD30B, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Centromeric for ANKRD30B facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Centromeric for ANKRD30B and elevate your work to new heights.