dPCR Microbial DNA Detection Assay for Prevotella denticola

GeneGlobe ID: DMA00265 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Prevotella denticola
GeneGlobe Cat.No. (Assay ID)​
DMA00265
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Prevotella denticola (28129)
Bacteroides denticola
Template accession​
AY323524.1
Taxonomy​
Bacteria
Application field​
Human Microbiome
Fermentation and Degradation
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
AGGGGAAACGGCATTGAGTGCTTGCACTGAATGGACGTCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCCGTTACTGCGGGATAACCTGCCGAAAGGCAGACTAATACCGCATGTTCTTCGATGACGGCATCAGA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Prevotella denticola, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Prevotella denticola models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Prevotella denticola facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Prevotella denticola studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Prevotella denticola and elevate your work to new heights.