Viral detection assay
Alternative names of species: PMMoV
dPCR wet-lab verified
Product name
Pepper mild mottle virus
GeneGlobe Cat.No. (Assay ID)
DMA00722
Target region
Pepper mild mottle virus used as an fecal indicator for RNA targets
Target (NCBI taxonomy ID)
Pepper mild mottle virus (12239)
pepper mild mottle virus PMMV-S
Application field
Positive Control Assay
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TGTGGTTTCAAATGAGAGTGGTTTGACCTTAACGTTTGAGAGGCCTACCGAAGCAAATGTCGCACTTGCATTGCAACCGACAATTACATCAAAGGAGG