dPCR Microbial DNA Detection Assay for Pseudomonas putida

GeneGlobe ID: DMA00279 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Pseudomonas putida
GeneGlobe Cat.No. (Assay ID)​
DMA00279
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Pseudomonas putida (303)
Arthrobacter siderocapsulatus
Bacillus fluorescens putidus
Bacillus putidus
Pseudomonas arvilla
Pseudomonas convexa
Pseudomonas eisenbergii
Pseudomonas incognita
Pseudomonas ovalis
Pseudomonas rugosa
Pseudomonas striata
Template accession​
NC_010322.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Pseudomonas alcaligenes (43263)
Stutzerimonas stutzeri (316)
Achromobacter sewerinii
Achromobacter stutzeri
Bacillus denitrificans II
Bacillus nitrogenes
Bacillus stutzeri
Pseudomonas perfectomarina (ex ZoBell and Upham 1944) Baumann et al. 1983
Pseudomonas perfectomarina
Pseudomonas stutzeri (Lehmann and Neumann 1896) Sijderius 1946 (Approved Lists 1980)
Stutzerimonas perfectomarina
Pseudomonas mendocina (300)
Pseudomonas plecoglossicida (70775)
Pseudomonas entomophila (312306)
Pseudomonas nitroreducens (46680)
Pseudomonas azelaica
Application field​
Biocontrol
Fermentation and Degradation
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCTTATTCTGTCGGTAACGTCAAAACAGCAAGGTATTAACTTACTGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGACTGATCATCCTCTCAGACCAGTTACGGATCGTCGCCTTGGTGAGCCATTACCCCACCAACTAGCTAATCCGACCTAGGCTCATCTGATAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCGTTCCTTTCGAAACGTTGTCCCCCACTACC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 232.93 KBLanguage: English

Microbiology Research Areas

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pseudomonas putida, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pseudomonas putida models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pseudomonas putida facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pseudomonas putida studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pseudomonas putida and elevate your work to new heights.