dPCR Microbial DNA Detection Assay for Bacillus subtilis

GeneGlobe ID: DMA00043 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Bacillus subtilis
GeneGlobe Cat.No. (Assay ID)​
DMA00043
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Bacillus subtilis (1423)
Bacillus natto
Bacillus uniflagellatus
Vibrio subtilis
Template accession​
AB110598.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Bacillus velezensis (492670)
Bacillus amyloliquefaciens subsp. plantarum
Bacillus methylotrophicus Madhaiyan et al. 2010 emend. Dunlap et al. 2015
Bacillus methylotrophicus subsp. plantarum
Bacillus methylotrophicus
Bacillus oryzicola
Bacillus tequilensis (227866)
Bacillus stercoris (2054641)
Bacillus subtilis subsp. stecoris
Bacillus amyloliquefaciens (1390)
Bacillus amyloliquefaciens subsp. amyloliquefaciens
Bacillus amyloliquifaciens
Application field​
Probiotics
Gastrointestinal Infections
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 238.74 KBLanguage: English

MicrobiologyResearchAreas_Title

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Bacillus subtilis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bacillus subtilis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Bacillus subtilis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bacillus subtilis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Bacillus subtilis and elevate your work to new heights.