dPCR CNV Probe Gene of Interest for FANCA

GeneGlobe ID: DCG0000153 | Cat. No.: 250210 | dPCR CNV Probe Assays

Product Specification

Gene symbol: FANCA
Ensembl Gene ID: ENSG00000187741
dPCR wet-lab verified
Product Name​
dPCR CNV Probe Gene of Interest for FANCA
GeneGlobe Cat.No. (Assay ID)​
DCG0000153
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
FANCA
Ensembl Gene ID​
ENSG00000187741
NCBI Gene Id​
2175
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
92
Amplicon region​
TCTCTACAGAAGATCCACAATTCTTCGCATTGTCAGAAGAAACCTGGAAGTAGTCATCCCCTTCTAACCGTTGCTGCATACCTCTTCAGAGACTCTATAAACGCCACACGGGAGTCAGGGAC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab verified​
dPCR wet-lab verified
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 223.02 KBLanguage: English

Resources

Introducing the dPCR CNV Probe Gene of Interest for FANCA, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for FANCA facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for FANCA and elevate your work to new heights.