dPCR Microbial DNA Detection Assay for Aspergillus niger

GeneGlobe ID: DMA00365 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the ITS1 and 5.8S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Aspergillus niger
GeneGlobe Cat.No. (Assay ID)​
DMA00365
Target type​
Microbial Id
Target region​
ITS1 and 5.8S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Aspergillus niger (5061)
Aspergillus lacticoffeatus Frisvad & Samson, 2004
Aspergillus lacticoffeatus
Template accession​
GU256739
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Aspergillus phoenicis (5063)
Aspergillus saitoi
Aspergillus saitoi var. kagoshimaensis
Ustilago phoenicis
Aspergillus foetidus (63131)
Aspergillus tubingensis (5068)
Aspergillus niger var. tubingensis
Aspergillus awamori (105351)
Aspergillus niger var. awamori
Aspergillus costaricensis (319631)
Aspergillus costaricensis Samson & Frisvad 2004
Aspergillus piperis (319630)
Aspergillus ficuum (5058)
Aspergillus niger var. ficuum
Sterigmatocystis ficuum
Ustilago ficuum
Application field​
Environmental Microbes
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 247.55 KBLanguage: English

MicrobiologyResearchAreas_Title

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Aspergillus niger, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Aspergillus phoenicis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Aspergillus niger facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Aspergillus phoenicis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Aspergillus niger and elevate your work to new heights.