dPCR Microbial DNA Detection Assay for African swine fever virus

GeneGlobe ID: DMA00716 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: ASFV
dPCR wet-lab verified
Product name​
African swine fever virus
GeneGlobe Cat.No. (Assay ID)​
DMA00716
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
African swine fever virus (10497)
African swine fever virus ASF
African swine fever virus ASFV
African swine fever virus, ASFV
ASFV
Template accession​
B646L
Taxonomy​
Viruses
Application field​
Animal Disease
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GCCCTACCATCTCATGTGGAAGTATTATGAAACGCGAGACAGTGAAAAGATGGCCGACGTGGCCTACTACTGCATTATAGATGCCCAGCGCTGTCAGGACCTTCTGGTGCGCCACAATGTTATCCCCGATCG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 97.25 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for African swine fever virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with African swine fever virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for African swine fever virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for African swine fever virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for African swine fever virus and elevate your work to new heights.