dPCR CNV Probe Gene of Interest for GRM7

GeneGlobe ID: DCG0000154 | Cat. No.: 250210 | dPCR CNV Probe Assays

Product Specification

Gene symbol: GRM7
Ensembl Gene ID: ENSG00000196277
dPCR wet-lab verified
Product Name​
dPCR CNV Probe Gene of Interest for GRM7
GeneGlobe Cat.No. (Assay ID)​
DCG0000154
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
GRM7
Ensembl Gene ID​
ENSG00000196277
NCBI Gene Id​
2917
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
93
Amplicon region​
TAATACCATGGAAAGTGCATTAGGTATGAACAACATCTCAGGACTCAGCATGGTGTCTTATGCTGTCCTCGCTTAGCAACAGCATCAAGGAAGTATTGCATATCCGGGATTCAGAATCTCCTC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab verified​
dPCR wet-lab verified
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 228.53 KBLanguage: English

Resources

Available Product Catalog (2)
Certificates of Analysis (1)
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Introducing the dPCR CNV Probe Gene of Interest for GRM7, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for GRM7 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for GRM7 and elevate your work to new heights.