GeneGlobe ID: DCC0000390 | Cat. No.: 250212 | dPCR CNV Probe Assays

dPCR CNV Probe Centromeric for ZMYM2

Select a variant to see the price

Product Specification

Gene symbol: ZMYM2
Ensembl Gene ID: ENSG00000121741
dPCR wet-lab validated
Centromeric 13 chromosome
Product Name​
dPCR CNV Probe Centromeric for ZMYM2
GeneGlobe Cat.No. (Assay ID)​
DCC0000390
Assay type​
Centromeric
Species​
Human (Homo sapiens)
Gene symbol​
ZMYM2
Ensembl Gene ID​
ENSG00000121741
NCBI Gene Id​
7750
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
71
Amplicon region​
TAGTTCTACAGATAGCCCTGTCTGGTATACGTCTACTTCACTGGACCGAAACACCTTGGAAAATATGCTTGTACGGGTTCTTCTAGTAAAAGATATTTATG
Recommended Restriction Enzyme​
AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
HEX, ROX
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns and 1000rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 228.93 KBLanguage: English

Resources

Application Notes (1)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Quick-Start Protocols (1)
Brochures & Guides (1)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR CNV Probe Centromeric for ZMYM2, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Centromeric for ZMYM2 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Centromeric for ZMYM2 and elevate your work to new heights.