dPCR Microbial DNA Detection Assay for Starmerella bacillaris

GeneGlobe ID: DMA00821 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Saccharomyces bacillaris, Torulopsis bacillaris, Cryptococcus bacillaris, Candida cf. stellata 10-372
Candida cf. stellata 10-373
Candida cf. stellata 10-374
Candida cf. stellata 10-375
Candida sp. EJ1
dPCR wet-lab verified
Product name​
Starmerella bacillaris
GeneGlobe Cat.No. (Assay ID)​
DMA00821
Target type​
Microbial Id
Target region​
ITS
Target (NCBI taxonomy ID)​
Starmerella bacillaris (1247836)
Candida zemplinina
Cryptococcus bacillaris
Saccharomyces bacillaris
Torulopsis bacillaris
Template accession​
MN915121.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CGGTCTTTGCAATTGCTTGGGTGTCGAAAGGCGCCCAATCTTTAAAACTTTTATATTTGTTCTGAAACAATGAAAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATTTTTGAACGCATATTGCGCTATTAGTTTGTCT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 88.45 KBLanguage: English

Microbiology Research Areas

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Starmerella bacillaris, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Starmerella bacillaris models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Starmerella bacillaris facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Starmerella bacillaris studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Starmerella bacillaris and elevate your work to new heights.