dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii

GeneGlobe ID: DMA00878 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Saccharomyces rouxii
dPCR wet-lab verified
Product name​
Zygosaccharomyces rouxii
GeneGlobe Cat.No. (Assay ID)​
DMA00878
Target type​
Microbial Id
Target region​
Golgi transport complex subunit COG6
Target (NCBI taxonomy ID)​
Zygosaccharomyces rouxii (4956)
Saccharomyces rouxii
Template accession​
CU928176.1
Taxonomy​
Plants and Fungi
Application field​
Food Testing
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AAAATTCGTTAAAATGTTCTAAATCATTGGAAAGGTAGATTAAACTCTTTTGAAATAATATGAAATTTTTATCATCAGGATCGAATGATCTTTCACCTAGAAGTTGAGAATTGGATTCATAATTGTGTAAAAAATCAACTAAATGGTTGAAAACTTTTTTATTGACAAAGCTTAGCGTTTGATTTGTTTGGGAAATT
Reaction size​
200rxns

MicrobiologyResearchAreas_Title

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Zygosaccharomyces rouxii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Zygosaccharomyces rouxii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Zygosaccharomyces rouxii and elevate your work to new heights.