Mirna Stemloop Summary
| id | hsa-mir-10b |
| Accession | MI0000267 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Michael et al. subsequently verified expression of miR-10b in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
| Description | Homo sapiens miR-10b stem-loop |
| Gene Family | MIPF0000033;mir-10 |
| Genome Context | chr2: 176150303-176150412 [+] |
| miRna Matures Links | |
| Sequence | CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA |