The following mature miRNA have the same seed sequence: CAGAUUC
| ID | hsa-miR-10b-3p |
| Accession | MIMAT0004556 |
| Sequence | 66 - ACAGAUUCGAUUCUAGGGGAAU - 87 |
| Seed Sequence | CAGAUUC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- tretinoin
disease
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- congenital adrenal hyperplasia