Stem-loop hsa-mir-378e [Human]

The following stemloop miRNA have the same biologically relevant information.

ID	hsa-mir-378e
Accession	MI0016750
Genome Context	chr5: 170028488-170028566 [+]
Sequence	CUGACUCCAGUGUCCAGGCCAGGGGCAGACAGUGGACAGAGAACAGUGCCCAAGACCACUGGACUUGGAGUCAGGACAU

miRNA-Specific Assays for Results You Can Trust

Streamline your workflow with assays designed for this miRNA. Our targeted qPCR assays help you generate meaningful data – efficiently and accurately.

Functional Analysis - Inhibitors
Functional Analysis - Mimics
Localization Studies
qPCR Expression - SYBR
qPCR Expression - Probe

Country and Language

Explore dPCR & qPCR assay portfolio

Digital PCR Multiplex Assay Compatibility Checker

Stem-loop hsa-mir-378e

miRNA-Specific Assays for Results You Can Trust