The following mature miRNA have the same seed sequence: CUGACUC
| ID | hsa-miR-345-5p |
| Accession | MIMAT0000772 |
| Sequence | 18 - GCUGACUCCUAGUCCAGGGCUC - 39 |
| Seed Sequence | CUGACUC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- papillary thyroid carcinoma
- papillary thyroid cancer
- malignant mesothelioma
- mesothelioma formation
- pancreatic cancer
- pancreatic ductal adenocarcinoma
- pancreatic epithelial cancer
- ductal pancreatic cancer
- lupus nephritis