The following mature miRNA have the same seed sequence: AACCUGG
| ID | hsa-miR-490-3p |
| Accession | MIMAT0002806 |
| Sequence | 76 - CAACCUGGAGGACUCCAUGCUG - 97 |
| Seed Sequence | AACCUGG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- tretinoin
- mir-346
- butein
disease
- colorectal adenocarcinoma
- colorectal carcinomagenesis