The following mature miRNA have the same seed sequence: AUGUGCC
| ID | hsa-miR-455-5p |
| Accession | MIMAT0003150 |
| Sequence | 16 - UAUGUGCCUUUGGACUACAUCG - 37 |
| Seed Sequence | AUGUGCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- experimental autoimmune encephalomyelitis
- colorectal cancer
- bladder neoplasm
- bladder neoplasia
- aortic valve calcification
- nonobstructive azoospermia
role in cell
- proliferation
- migration
- invasion
- invasion by
- epithelial-mesenchymal transition