The following mature miRNA have the same seed sequence: AUGGCGC
| ID | hsa-miR-652-3p |
| Accession | MIMAT0003322 |
| Sequence | 61 - AAUGGCGCCACUAGGGUUGUG - 81 |
| Seed Sequence | AUGGCGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- Influenza A virus strain A/TX/36/91
- PAX3-FOXO1
- Influenza A virus (A/Brevig Mission/1/1918(H1N1))
disease
- schizophrenia
- epithelial cancer
- breast cancer
- liver cancer
- nasopharyngeal carcinoma
- nasopharyngeal cancer
- liposarcoma
- soft tissue sarcoma cancer
- nonobstructive azoospermia