The following mature miRNA have the same seed sequence: GUUCUUC
| ID | hsa-miR-22-5p |
| Accession | MIMAT0004495 |
| Sequence | 15 - AGUUCUUCAGUGGCAAGCUUUA - 36 |
| Seed Sequence | GUUCUUC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- bipolar disorder
- severe asthma
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- colorectal adenocarcinoma
- colorectal carcinomagenesis
regulated by
- T lymphocytes
- macrophages
- vorinostat
role in cell
- expression in