The following mature miRNA have the same seed sequence: UGAAUUA
| ID | hsa-miR-183-3p |
| Accession | MIMAT0004560 |
| Sequence | 66 - GUGAAUUACCGAAGGGCCAUAA - 87 |
| Seed Sequence | UGAAUUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- PAX3-FOXO1
disease
- neoplasia
- psoriasis
- degenerative disc disease
- mammary neoplasm