The following mature miRNA have the same seed sequence: GAUAUCA
| ID | hsa-miR-144-5p |
| Accession | MIMAT0004600 |
| Sequence | 15 - GGAUAUCAUCAUAUACUGUAAG - 36 |
| Seed Sequence | GAUAUCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- nilotinib
disease
- neoplasia
- epithelial cancer
- mammary neoplasm
- gallbladder cancer
- colorectal adenocarcinoma
- mesothelioma formation
- malignant mesothelioma
- colorectal carcinomagenesis
- sporadic amyotrophic lateral sclerosis
- primary open-angle glaucoma
role in cell
- proliferation