The following mature miRNA have the same seed sequence: GAUUCCU
| ID | hsa-miR-145-3p |
| Accession | MIMAT0004601 |
| Sequence | 54 - GGAUUCCUGGAAAUACUGUUCU - 75 |
| Seed Sequence | GAUUCCU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- mammary neoplasm
- neoplasia
- breast cancer
- bipolar disorder
- colorectal adenocarcinoma
- colorectal carcinomagenesis
- small cell lung cancer
- papillary thyroid carcinoma
- papillary thyroid cancer
role in cell
- gemcitabine sensitivity
- cisplatin sensitivity