The following mature miRNA have the same seed sequence: AUCAUCG
| ID | hsa-miR-136-3p |
| Accession | MIMAT0004606 |
| Sequence | 49 - CAUCAUCGUCUCAAAUGAGUCU - 70 |
| Seed Sequence | AUCAUCG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- LMNA-related congenital muscular dystrophy
- idiopathic pulmonary fibrosis