The following mature miRNA have the same seed sequence: CCCCCAG
| ID | hsa-miR-361-3p |
| Accession | MIMAT0004682 |
| Sequence | 45 - UCCCCCAGGUGUGAUUCUGAUUU - 67 |
| Seed Sequence | CCCCCAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- colorectal cancer
- HER2 negative hormone receptor negative breast cancer
role in cell
- expression in
- proliferation
- number
- differentiation
- sorafenib resistance
- invasion by
- autophagy in