The following mature miRNA have the same seed sequence: GGAGCCA
| ID | hsa-miR-505-5p |
| Accession | MIMAT0004776 |
| Sequence | 15 - GGGAGCCAGGAAGUAUUGAUGU - 36 |
| Seed Sequence | GGAGCCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- T lymphocytes
- RPS15
disease
- LMNA-related congenital muscular dystrophy