The following mature miRNA have the same seed sequence: CCAUUAC
| ID | hsa-miR-885-5p |
| Accession | MIMAT0004947 |
| Sequence | 11 - UCCAUUACACUACCCUGCCUCU - 32 |
| Seed Sequence | CCAUUAC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- renal clear cell adenocarcinoma
- renal clear cell cancer
- colorectal cancer
role in cell
- differentiation
- number
- cytokinesis
- synthesis in