The following mature miRNA have the same seed sequence: GGCAGGG
| ID | hsa-miR-1207-5p |
| Accession | MIMAT0005871 |
| Sequence | 8 - UGGCAGGGAGGCUGGGAGGGG - 28 |
| Seed Sequence | GGCAGGG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- prostate cancer
- immune thrombocytopenia
- HER2 negative hormone receptor negative breast cancer
- amyotrophic lateral sclerosis
- breast ductal carcinoma in situ
- ductal in situ breast cancer
regulated by
- rimonabant
- PAX3-FOXO1
- acetaminophen
- PLCE1