The following mature miRNA have the same seed sequence: GAGUGCC
| ID | hsa-miR-1909-5p |
| Accession | MIMAT0007882 |
| Sequence | 16 - UGAGUGCCGGUGCCUGCCCUG - 36 |
| Seed Sequence | GAGUGCC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- dilated cardiomyopathy
regulated by
- RNA polymerase iii