miRNA Mature hsa-miR-1193 [Human]

The following mature miRNA have the same seed sequence: GGAUGGU

ID	hsa-miR-1193
Accession	MIMAT0015049
Sequence	10 - GGGAUGGUAGACCGGUGACGUGC - 32
Seed Sequence	GGAUGGU

miRNA-Specific Assays for Results You Can Trust

Streamline your workflow with assays designed for this miRNA. Our targeted qPCR assays help you generate meaningful data – efficiently and accurately.

Functional Analysis - Inhibitors
Functional Analysis - Mimics
Localization Studies
qPCR Expression - SYBR
qPCR Expression - Probe

Country and Language

Explore dPCR & qPCR assay portfolio

Digital PCR Multiplex Assay Compatibility Checker

miRNA Mature hsa-miR-1193

miRNA-Specific Assays for Results You Can Trust