The following mature miRNA have the same seed sequence: CCCUGAC
| ID | hsa-miR-4732-3p |
| Accession | MIMAT0019856 |
| Sequence | 43 - GCCCUGACCUGUCCUGUUCUG - 63 |
| Seed Sequence | CCCUGAC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- fibrosis
- weight loss
regulates
- reactive oxygen species
role in cell
- cell viability
- apoptosis