miRNA Mature hsa-miR-101-2-5p [Human]

The following mature miRNA have the same seed sequence: CGGUUAU

ID	hsa-miR-101-2-5p
Accession	MIMAT0037312
Sequence	12 - UCGGUUAUCAUGGUACCGAUGC - 33
Seed Sequence	CGGUUAU
Synonyms	mmu-miR-101b-5p rno-miR-101b-5p

miRNA-Specific Assays for Results You Can Trust

Streamline your workflow with assays designed for this miRNA. Our targeted qPCR assays help you generate meaningful data – efficiently and accurately.

Functional Analysis - Inhibitors
Functional Analysis - Mimics
Localization Studies
qPCR Expression - SYBR
qPCR Expression - Probe

Country and Language

Explore dPCR & qPCR assay portfolio

Digital PCR Multiplex Assay Compatibility Checker

miRNA Mature hsa-miR-101-2-5p

miRNA-Specific Assays for Results You Can Trust